Yum, spotting regulations...

regul@tion spotting

documentation

Likely effect

functional (high confidence)

Model: extratranscriptic, score: 83.3060975609756      
Summary
  • within TFBS
  • within active promoter
hyperlink
analysed issue analysis result
name of alteration no title
alteration (phys. location) chr1:27113734T>C   IGV
alteration type single base exchange
alteration region extratranscriptic
known variant Reference ID: rs574885709
Allele 'C' was neither found in ExAC nor 1000G.
promoters
RegulationSpotter
1: 27113463-27114013 DNase1H3K4me3PIGVENST00000430292
enhancers none found
epigenetic marks (RegulationSpotter)
DNase1DNase1 hypersensitive site in promoter1:27112484-27116077
H3K4me3H3K4me3 in 3 cell lines, overlap with promoter1:27112895-27115976
histone modifications
H2AZ GM12878, K562 show features in Ensembl  explain
H2BK120ac IMR90
H3K18ac IMR90
H3K27ac NHDF-AD, NHEK, DND-41, Osteobl, IMR90, NHLF, GM12878, K562, HSMM, HSMMtube, HepG2, NH-A, A549, HMEC, HeLa-S3, Monocytes-CD14+
H3K4ac IMR90
H3K4me1 NHDF-AD, NHEK, DND-41, HUVEC, HepG2, Monocytes-CD14+, HeLa-S3
H3K4me2 NHDF-AD, NHEK, DND-41, H1ESC, Osteobl, IMR90, HUVEC, GM12878, K562, HepG2, HSMM, HSMMtube, NH-A, Monocytes-CD14+, A549, HMEC, HeLa-S3
H3K4me3 NHDF-AD, DND-41, H1ESC, Osteobl, IMR90, NHLF, HUVEC, GM12878, K562, HepG2, HSMM, NH-A, Monocytes-CD14+, A549, HMEC, HeLa-S3
H3K56ac IMR90
H3K9ac NHDF-AD, NHEK, DND-41, H1ESC, IMR90, NHLF, HUVEC, GM12878, K562, HepG2, HSMM, HSMMtube, NH-A, Monocytes-CD14+, A549, HMEC, HeLa-S3
H4K5ac H1ESC, IMR90
H4K8ac IMR90
H4K91ac IMR90
polymerase
PolII H1ESC, HUVEC, GM12878, K562, HepG2, HeLa-S3 show features in Ensembl  explain
open chromatin
DNase1 NHDF-AD, H1ESC, IMR90, NHLF, HUVEC, GM12878, K562, HSMM, HSMMtube, NH-A show features in Ensembl  explain
TF binding sites
BCL3 GM12878 show features in Ensembl  explain
CTCF H1ESC
HEY1 K562
Max K562
TAF1 H1ESC, K562
Yy1 H1ESC, GM12878, K562
test for effects on TFBSs with ePOSSUM
genomic interactions HiC interactions
affected gene(s) elementcell linestranscripts
gene symbolEnsembl ID HUVECHeLaNHEK
PIGV ENSG00000060642promoter +++protein-coding: ENST00000430292
ARID1A ENSG00000117713overlaps with promoter +++nonsense_mediated_decay: ENST00000532781
PIGV ENSG00000060642overlaps with promoter +++protein-coding: ENST00000078527, ENST00000374145, ENST00000431541, ENST00000449950, ENST00000455364 nonsense_mediated_decay: ENST00000472757

show interactions as plot
phyloP / phastCons
PhyloPPhastCons
(flanking)0.3770.949
1.1540.962
(flanking)2.0960.962
explain score(s) and/or inspect your position(s) in in UCSC Genome Browser
chromosome 1
strand 1
chromosomal position
(for ins/del: last normal base / first normal base)
27113734
original chrDNA sequence snippet AAACTGGCCGCTCCCCCCAATAGACGGTTTTGTTGAGTTCG
altered chrDNA sequence snippet AAACTGGCCGCTCCCCCCAACAGACGGTTTTGTTGAGTTCG
speed 1.04 s

All positions are in basepairs (bp) if not explicitely stated differently.
Abbreviations: aa: amino acid; CDS: coding sequence; mu: mutated; NMD: nonsense-mediated mRNA decay; nt: nucleotide; wt: wildtype; TGP: 1000 Genomes Project

show score composition

mod_perl version: mod_perl/2.0.4