Yum, spotting regulations...

regul@tion spotting

documentation

Likely effect

functional (high confidence)

Model: extratranscriptic, score: 83.3060975609756      
Summary
  • within TFBS
  • within active promoter
hyperlink
analysed issue analysis result
name of alteration no title
alteration (phys. location) chr1:27113734T>C   IGV
alteration type single base exchange
alteration region extratranscriptic
known variant Reference ID: rs574885709
Allele 'C' was neither found in ExAC nor 1000G.
promoters
RegulationSpotter
1: 27113463-27114013 DNase1H3K4me3PIGVENST00000430292
enhancers none found
epigenetic marks (RegulationSpotter)
DNase1DNase1 hypersensitive site in promoter1:27112484-27116077
H3K4me3H3K4me3 in 3 cell lines, overlap with promoter1:27112895-27115976
histone modifications
genomic
feature
blood bone conn.tiss. ESC monocyte muscle neural skin brain eye retina gingiva gum esophag. lung heart breast liver pancreas colon kidney umbilica amnion chorion cervix prostate testis multicel
H2AZGM12878
K562
H2BK120acIMR90
H3K18acIMR90
H3K27acDND-41
GM12878
K562
Osteobl Monocytes-CD14+ HSMM
HSMMtube
NH-A NHDF-AD
NHEK
A549
IMR90
NHLF
HMEC HepG2 HeLa-S3
H3K4acIMR90
H3K4me1DND-41 Monocytes-CD14+ NHDF-AD
NHEK
HepG2 HUVEC HeLa-S3
H3K4me2DND-41
GM12878
K562
Osteobl H1ESC Monocytes-CD14+ HSMM
HSMMtube
NH-A NHDF-AD
NHEK
A549
IMR90
HMEC HepG2 HUVEC HeLa-S3
H3K4me3DND-41
GM12878
K562
Osteobl H1ESC Monocytes-CD14+ HSMM NH-A NHDF-AD A549
IMR90
NHLF
HMEC HepG2 HUVEC HeLa-S3
H3K56acIMR90
H3K9acDND-41
GM12878
K562
H1ESC Monocytes-CD14+ HSMM
HSMMtube
NH-A NHDF-AD
NHEK
A549
IMR90
NHLF
HMEC HepG2 HUVEC HeLa-S3
H4K5acH1ESC IMR90
H4K8acIMR90
H4K91acIMR90
show features in Ensembl  explain
polymerase
genomic
feature
blood bone conn.tiss. ESC monocyte muscle neural skin brain eye retina gingiva gum esophag. lung heart breast liver pancreas colon kidney umbilica amnion chorion cervix prostate testis multicel
PolIIGM12878
K562
H1ESC HepG2 HUVEC HeLa-S3
show features in Ensembl  explain
open chromatin
genomic
feature
blood bone conn.tiss. ESC monocyte muscle neural skin brain eye retina gingiva gum esophag. lung heart breast liver pancreas colon kidney umbilica amnion chorion cervix prostate testis multicel
DNase1GM12878
K562
H1ESC HSMM
HSMMtube
NH-A NHDF-AD IMR90
NHLF
HUVEC
show features in Ensembl  explain
TF binding sites
genomic
feature
blood bone conn.tiss. ESC monocyte muscle neural skin brain eye retina gingiva gum esophag. lung heart breast liver pancreas colon kidney umbilica amnion chorion cervix prostate testis multicel
BCL3GM12878
CTCFH1ESC
HEY1K562
MaxK562
TAF1K562 H1ESC
Yy1GM12878
K562
H1ESC
show features in Ensembl  explain  test for effects on TFBSs with ePOSSUM
genomic interactions HiC interactions
associated gene(s) interacting element harbouring variant...cell linestranscripts of associated gene
gene symbolEnsembl ID HUVECHeLaNHEK
PIGV ENSG00000060642promoter +++protein-coding: ENST00000430292
ARID1A ENSG00000117713overlaps with promoter +++nonsense_mediated_decay: ENST00000532781
PIGV ENSG00000060642overlaps with promoter +++protein-coding: ENST00000078527, ENST00000374145, ENST00000431541, ENST00000449950, ENST00000455364 nonsense_mediated_decay: ENST00000472757

show interactions as plot
phyloP / phastCons
PhyloPPhastCons
(flanking)0.3770.949
1.1540.962
(flanking)2.0960.962
explain score(s) and/or inspect your position(s) in in UCSC Genome Browser
chromosome 1
strand 1
chromosomal position
(for ins/del: last normal base / first normal base)
27113734
original chrDNA sequence snippet AAACTGGCCGCTCCCCCCAATAGACGGTTTTGTTGAGTTCG
altered chrDNA sequence snippet AAACTGGCCGCTCCCCCCAACAGACGGTTTTGTTGAGTTCG
speed 0.74 s

All positions are in basepairs (bp) if not explicitly stated differently.
Abbreviations: aa: amino acid; CDS: coding sequence; mu: mutated; NMD: nonsense-mediated mRNA decay; nt: nucleotide; wt: wildtype; TGP: 1000 Genomes Project

show score composition

mod_perl version: mod_perl/2.0.4